Open-Source Biology Logic Gates

This topic was published by and viewed 1360 times since "". The last page revision was "".

Viewing 1 post (of 1 total)
  • Author
    Posts
  • DevynCJohnson
    DevynCJohnson
    Keymaster
    • Topics - 444
    • @devyncjohnson

    Logic gates are very important in computing. Without logic gates, processors and many electronic devices would not be possible. Many developers and engineers are trying to design logic gates using other materials. This research may help to invent a smaller, more inexpensive, or faster processor. In 2013, scientists have finished making biological logic gates.
    March 28, 2013 was the day that a Stanford University team of bioengineers led by Professor Drew Endy finished their revolutionary work. They invented a biological equivalent of a transistor called a "transcriptor". Stanford University released this invention to the Public Domain; thus, helping to promote this technology. This also begins the idea (started by Prof. Endy) of "open-source biology".
    Logic gates made of DNA or RNA are called Boolean Integrase Logic (BIL) gates. While silicon transistors control the flow of electrons, these DNA/RNA based transistors (transcriptors) control the flow of polymerase molecules. These transcriptors are compatible with serine recombinases.
    Below, the nucleic acid codes for each BIL gate (made by Professor Drew Endy <Endy@Stanford.edu>). A single letter represents a nucleotide which is a monomer (subunit) of a larger organic molecule.

    • a - (Purine) Adenine
    • c - (Pyrimidine) Cytosine
    • g - (Purine) Guanine
    • t - (Pyrimidine) Thymine

    OR

    atgccaacacaattaacatctcaatcaaggtaaatgctttttgctttttttgctcggccggcttgtcgacgacggcggtctccgtcgtcaggatcatccgggcccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatcgtggtttgtctggtcaaccaccgcggtctcagtggtgtacggtacaaacccgcgagtttttatttcgtttatttcaattaaggtaactaaaaaactccttt

    NOR

    atgccaacacaattaacatctcaatcaaggtaaatgctttttgctttttttgctataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggaaaggagttttttagttaccttaattgaaataaacgaaataaaaactcgctcggccggcttgtcgacgacggcggtctccgtcgtcaggatcatccgggctttcttttgggtatagcgtcgtggacagtcattcatctttctgcccctccaaaagcaaaaacccgccgaagcgggtttttacgtaaatcaggtgaaactgaccgataagccgggggtttgtaccgtacaccactgagaccgcggtggttgaccagacaaaccacga

    AND

    atgccaacacaattaacatctcaatcaaggtaaatgctttttgctttttttgcccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataaaaggagttttttagttaccttaattgaaataaacgaaataaaaactcgcgctagctcggccggcttgtcgacgacggcggtctccgtcgtcaggatcatccgggcccggcttatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccacgacgctatacccaaaagaaagggtttgtaccgtacaccactgagaccgcggtggttgaccagacaaaccacga

    NAND

    atgccaacacaattaacatctcaatcaaggtaaatgctttttgctttttttgctataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggaaaggagttttttagttaccttaattgaaataaacgaaataaaaactcgctcggccggcttgtcgacgacggcggtctccgtcgtcaggatcatccgggcttgacaattaatcatccggctcgtagggtttgtggagggtttgtaccgtacaccactgagaccgcggtggttgaccagacaaaccacga

    XOR

    atgccaacacaattaacatctcaatcaaggtaaatgctttttgctttttttgctcggccggcttgtcgacgacggcggtctccgtcgtcaggatcatccgggccatatgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataatgcatgggtttgtaccgtacaccactgagaccgcggtggttgaccagacaaaccacgaaaaggagttttttagttaccttaattgaaataaacgaaataaaaactcgc

    XNOR

    atgccaacacaattaacatctcaatcaaggtaaatgctttttgctttttttgctcggccggcttgtcgacgacggcggtctccgtcgtcaggatcatccgggctataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctgggggtttgtaccgtacaccactgagaccgcggtggttgaccagacaaaccacgaaaaggagttttttagttaccttaattgaaataaacgaaataaaaactcgc

    OR_RW

    ATGCCAACACAATTAACATCTCAATTAAGGTAACTAAAAAACTCCTTTTAAGGccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataGCAAAAAAAGCAAAAAGCATTTACCTTGATTGAAATAAACGAAATAAAAACTCTCGGCCGGCTTGTCGACGACGGCGGTCTCAGTGGTGTACGGTACAAACCCtccacaaaccctacgagccggatgattaattgtcaaGCCCGGATGATCCTGACGACGGAGACCGCGGTGGTTGACCAGACAAACCACGA

    NOR_RW

    ATGCCAACACAATTAACATCTCAATTAAGGTAACTAAAAAACTCCTTTTAAGGtataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggGCAAAAAAAGCAAAAAGCATTTACCTTGATTGAAATAAACGAAATAAAAACTCGCTAGCTCGGCCGGCTTGTCGACGACGGCGGTCTCAGTGGTGTACGGTACAAACCCtttcttttgggtatagcgtcgtggacagtcattcatctttctgcccctccaaaagcaaaaacccgccgaagcgggtttttacgtaaatcaggtgaaactgaccgataagccggGCCCGGATGATCCTGACGACGGAGACCGCGGTGGTTGACCAGACAAACCACGA

    AND_RW

    ATGCCAACACAATTAACATCTCAATTAAGGTAACTAAAAAACTCCTTTTAAGGccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataGCAAAAAAAGCAAAAAGCATTTACCTTGATTGAAATAAACGAAATAAAAACTCGCTAGCTCGGCCGGCTTGTCGACGACGGCGGTCTCAGTGGTGTACGGTACAAACCCccggcttatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccacgacgctatacccaaaagaaaGCCCGGATGATCCTGACGACGGAGACCGCGGTGGTTGACCAGACAAACCACGA

    NAND_RW

    ATGCCAACACAATTAACATCTCAATTAAGGTAACTAAAAAACTCCTTTTAAGGtataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggGCAAAAAAAGCAAAAAGCATTTACCTTGATTGAAATAAACGAAATAAAAACTCTCGGCCGGCTTGTCGACGACGGCGGTCTCAGTGGTGTACGGTACAAACCCttgacaattaatcatccggctcgtagggtttgtggaGCCCGGATGATCCTGACGACGGAGACCGCGGTGGTTGACCAGACAAACCACGA

    XOR_RW

    ATGCCAACACAATTAACATCTCAATTAAGGTAACTAAAAAACTCCTTTTAAGGTCGGCCGGCTTGTCGACGACGGCGGTCTCAGTGGTGTACGGTACAAACCCcatatgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataatgcatGCCCGGATGATCCTGACGACGGAGACCGCGGTGGTTGACCAGACAAACCACGAGCAAAAAAAGCAAAAAGCATTTACCTTGATTGAAATAAACGAAATAAAAACTC

    XNOR_RW

    ATGCCAACACAATTAACATCTCAATTAAGGTAACTAAAAAACTCCTTTTAAGGTCGGCCGGCTTGTCGACGACGGCGGTCTCAGTGGTGTACGGTACAAACCCcatatgtataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggatgcatGCCCGGATGATCCTGACGACGGAGACCGCGGTGGTTGACCAGACAAACCACGAGCAAAAAAAGCAAAAAGCATTTACCTTGATTGAAATAAACGAAATAAAAACTC

    Further Reading

Viewing 1 post (of 1 total)